The nucleus of an atom is composed of two subatomic particles, ______________ and _____________. 

All cells in a multicellular organism contain the same genes.

In nucleotide excision repair, how is damaged DNA removed?

A different BIOL 190 student transcribed the same DNA sequence above and gave an answer of: 5’GAUUUGAUUUCUAAUGAGAGCGGUAUUCUAGCAUUCGCGCAACGCCAUGUAGGUGAAUUU 3’ Is this correct?

The events of the last four questions will continue until what happens?

During translation, ______ is  produced from the information in ______.

The form of chromatin seen in chromosomes during mitosis.

What enzyme removes primers from the new strand of DNA?

All of the following are correct about mutations except: 

In the initiation phase of translation, the first component to attach to the mRNA is the: