Skip to main navigationSkip to main contentSkip to footer
Wiki Cram
  • Home
  • Blog
Wiki Cram

Author: Anonymous (page 37,395)

The nucleus of an atom is composed of two subatomic particle…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
The nucleus of an atom is composed of two subatomic particles, ______________ and _____________. 
Continue reading “The nucleus of an atom is composed of two subatomic particle…”…

All cells in a multicellular organism contain the same genes…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
All cells in a multicellular organism contain the same genes.
Continue reading “All cells in a multicellular organism contain the same genes…”…

In nucleotide excision repair, how is damaged DNA removed?

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
In nucleotide excision repair, how is damaged DNA removed?
Continue reading “In nucleotide excision repair, how is damaged DNA removed?”…

A different BIOL 190 student transcribed the same DNA sequen…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
A different BIOL 190 student transcribed the same DNA sequence above and gave an answer of: 5’GAUUUGAUUUCUAAUGAGAGCGGUAUUCUAGCAUUCGCGCAACGCCAUGUAGGUGAAUUU 3’ Is this correct?
Continue reading “A different BIOL 190 student transcribed the same DNA sequen…”…

The events of the last four questions will continue until wh…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
The events of the last four questions will continue until what happens?
Continue reading “The events of the last four questions will continue until wh…”…

During translation, ______ is  produced from the information…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
During translation, ______ is  produced from the information in ______.
Continue reading “During translation, ______ is  produced from the information…”…

The form of chromatin seen in chromosomes during mitosis.

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
The form of chromatin seen in chromosomes during mitosis.
Continue reading “The form of chromatin seen in chromosomes during mitosis.”…

What enzyme removes primers from the new strand of DNA?

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
What enzyme removes primers from the new strand of DNA?
Continue reading “What enzyme removes primers from the new strand of DNA?”…

All of the following are correct about mutations except: 

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
All of the following are correct about mutations except: 
Continue reading “All of the following are correct about mutations except: ”…

In the initiation phase of translation, the first component…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
In the initiation phase of translation, the first component to attach to the mRNA is the:
Continue reading “In the initiation phase of translation, the first component…”…
« Previous page 1 … 37,393 37,394 37,395 37,396 37,397 … 89,220 Next page »
Powered by Studyeffect
  • Privacy Policy
  • Terms of Service
Copyright © 2026 WIKI CRAM — Powered by NanoSpace