Human height shows a continuous variation from the very short to the very tall. Height is most likely controlled by:
After the event in the previous question, what will happen n…
After the event in the previous question, what will happen next?
The primers that DNA polymerase adds nucleotides to are made…
The primers that DNA polymerase adds nucleotides to are made of:
Another BIOL 190 student transcribed the same DNA sequence a…
Another BIOL 190 student transcribed the same DNA sequence above and gave an answer of: 5’UUUAAGUGGAUGUACCGCAACGCGCUUACGAUCUUAUGGCGAGAGUAAUCUUUAGUUUAG3’ Is this correct?
The trait of medium-sized leaves in iris is determined by th…
The trait of medium-sized leaves in iris is determined by the genetic condition PP’. Plants with large leaves are PP, while plants with small leaves are P’P’. A cross is made between two plants each with medium-sized leaves. They produce 80 seedlings. How would you describe the genotype of the plants with medium-sized leaves?
The phenotype of vestigial (short) wings (vg) in Drosophila…
The phenotype of vestigial (short) wings (vg) in Drosophila melanogaster is caused by a recessive mutant gene that independently assorts with a recessive gene for hairy (h ) body. Assume that a cross is made between a fly with normal wings (homozygous) and a hairy body and a fly with vestigial wings and normal body hair (homozygous). The wild-type F1 flies were crossed among each other to produce 1024 offspring. What is the genotype of the fly with the vestigial wings and normal body hair?
The phenotype of vestigial (short) wings (vg) in Drosophila…
The phenotype of vestigial (short) wings (vg) in Drosophila melanogaster is caused by a recessive mutant gene that independently assorts with a recessive gene for hairy (h ) body. Assume that a cross is made between a fly with normal wings (homozygous) and a hairy body and a fly with vestigial wings and normal body hair (homozygous). The wild-type F1 flies were crossed among each other to produce 1024 offspring. How many of the F2 flies would you expect to have normal wings and a hairy body?
Which of the following is a structural polysaccharide?
Which of the following is a structural polysaccharide?
When water droplets stick to each other, a property called c…
When water droplets stick to each other, a property called cohesion this is due to:
What type of chromosomal abnormality is shown in the followi…
What type of chromosomal abnormality is shown in the following karyotype?