Meier-Gorlin syndrome results from flaws in the licensing of origins in replication. Which is the most likely effect on DNA replication in effected individuals?

Which of the following molecules is synthesized using nucleotides containing the bases adenine, guanine, cytosine, and uracil?

Prokaryotic promoters contain the sequence TATAAT at a position _____ from the transcription start.

Assume a DNA molecular, with the primary structure listed below, has the expected secondary structure for biological DNA in a cell.  In this double stranded DNA molecule, how many 3´ hydroxyls are present? ​ 5’AATAGCGGATGCCCGAATACGAG 3’TTATCGCCTACGGGCTTATGCTC

Which of the following statements is TRUE of DNA polymerases of eukaryotic cells?

What types of bonds are created between adjacent ribonucleotides during the process of transcription?

In the diagram below, which letter indicates the 5’ end of the leading strand?  

Indicate which of the following statements is TRUE.

A normal chromosome in a higher eukaryotic species would NOT be expected to contain:

Hershey and Chase conducted experiments using radioactive isotopes to label DNA and protein in separate bacteriophage cultures and track if each molecule was transferred into infected cells with the genetic material of the phage.  Upon removal of bacteriophage coats from infected bacterial cells, where was the label for the DNA? What isoptope was used to label the DNA?