Part 2: Review Questions from Weeks 1-8

Essay A. All four mechanisms of evolution (mutation, migration, genetic drift, and natural selection) that we have discussed influence speciation.  Choose 3 of these mechanisms and for each describe (a) whether it helps or hinders speciation (or both) and (b) why it has that particular impact on speciation.

Use the following character matrix to build a phylogeny and then answer the following question about the tree you built. Question: Species 2 is most closely related to which of the following species (You might mark more than one response):   Trait A Trait B Trait C Trait D Trait E Trait F Trait G Species 1 0 0 1 0 0 1 0 Species 2 0 0 1 1 0 0 1 Species 3 1 1 1 0 0 0 1 Species 4 1 1 1 0 0 0 1 Species 5 1 0 1 0 1 0 1 Species 6 1 0 1 0 1 0 1 Outgroup 0 0 0 0 0 0 0

Essay B. Evolutionary trees, or phylogenies, are diagrams depicting relationships between a set of organisms or clades.  In common language explain how researchers can use nodes to determine how closely related organisms are to each other. In your explanation, please include 3 parts: (a) what does a node represents biologically? (b) how is time oriented on a phylogeny (i.e., where is deep time and where is more recent time)? and (c) what does the position of nodes (i.e., closer to the tips vs. closer to the base of the tree) mean in terms of relatedness of two species?  

What would result from a single nucleotide deletion (point mutation) in the middle of the coding sequence of a structural gene?

Use the following character matrix to build a phylogeny and then answer the following question about the tree you built. Question: Species 2 is most closely related to which of the following species (You might mark more than one response):   Trait A Trait B Trait C Trait D Trait E Trait F Trait G Species 1 0 0 1 0 0 1 0 Species 2 0 0 1 1 0 0 1 Species 3 1 1 1 0 0 0 1 Species 4 1 1 1 0 0 0 1 Species 5 1 0 1 0 1 0 1 Species 6 1 0 1 0 1 0 1 Outgroup 0 0 0 0 0 0 0

Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide?   Normal gene: ATGGCCGGCCCGAAAGAGACC          Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr          Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp

 The sequence of amino acids in a protein is its________ structure.

Which of the following statements about sex in a biological context are not true:

Which of the following is considered to be a ‘scientist stereotype’?