Bacterial repressors often work by

What binds to the stop codon?

Using the two template DNA sequences below, determine what type of mutation occurred. Normal DNA coding strand: 5’‐ATGTCACTTTGGTAGCAGGAT‐3’ Mutant DNA coding strand: 5’‐ATGTCACTTTGATAGCAGGAT‐3’

In eukaryotic translation initiation, the mRNA binds the small subunit before the tRNA does.

Our immune system rearranges DNA to create new antibodies through

Using the two template DNA sequences below, determine what type of mutation occurred. Normal DNA coding strand: 5’‐ATGTCACTTGAATAGCAGGAT‐3’ Mutant DNA coding strand: 5’‐ATGTCATTTGAATAGCAGGAT‐3’

Lab 8 and 9 Pre-Lab on Respiration and Fermentation This type of organism lives in an environment without oxygen, and cannot survive in environments with oxygen.

Mutations that interfere with SR protein binding can result in

Which protein is produced by only female Drosophila?

Dicer cleaves