Contraction of the posterior cricoarytenoid (PCA) muscle results in abduction of the vocal folds; innervation to the PCA is provided by the recurrent laryngeal branch of CN X.

The nucleus of an atom is composed of two subatomic particles, ______________ and _____________. 

What property of water is NOT attributable to hydrogen bonding between water molecules? 

When a cell in the human body ruptures, the immune system responds with inflammation. Which component of the ruptured cell elicits this response?

When water freezes into a solid, it’s molecules are packed together ________ densely than in a liquid state.

The lagging strand of DNA is built in pieces called:

A different BIOL 190 student transcribed the same DNA sequence above and gave an answer of: 5’GAUUUGAUUUCUAAUGAGAGCGGUAUUCUAGCAUUCGCGCAACGCCAUGUAGGUGAAUUU 3’ Is this correct?

A tightly wound nucleosome is not available for transcription.

Human height shows a continuous variation from the very short to the very tall. Height is most likely controlled by: 

Oxidative metabolism takes place in the ___________________ of the cell.