In an XX mammal, which X chromosome will be inactivated?
Contraction of the posterior cricoarytenoid (PCA) muscle res…
Contraction of the posterior cricoarytenoid (PCA) muscle results in abduction of the vocal folds; innervation to the PCA is provided by the recurrent laryngeal branch of CN X.
The nucleus of an atom is composed of two subatomic particle…
The nucleus of an atom is composed of two subatomic particles, ______________ and _____________.
What property of water is NOT attributable to hydrogen bondi…
What property of water is NOT attributable to hydrogen bonding between water molecules?
When a cell in the human body ruptures, the immune system re…
When a cell in the human body ruptures, the immune system responds with inflammation. Which component of the ruptured cell elicits this response?
When water freezes into a solid, it’s molecules are packed t…
When water freezes into a solid, it’s molecules are packed together ________ densely than in a liquid state.
The lagging strand of DNA is built in pieces called:
The lagging strand of DNA is built in pieces called:
A different BIOL 190 student transcribed the same DNA sequen…
A different BIOL 190 student transcribed the same DNA sequence above and gave an answer of: 5’GAUUUGAUUUCUAAUGAGAGCGGUAUUCUAGCAUUCGCGCAACGCCAUGUAGGUGAAUUU 3’ Is this correct?
A tightly wound nucleosome is not available for transcriptio…
A tightly wound nucleosome is not available for transcription.
Human height shows a continuous variation from the very shor…
Human height shows a continuous variation from the very short to the very tall. Height is most likely controlled by: