What enzyme removes primers from the new strand of DNA?
All of the following are correct about mutations except:
All of the following are correct about mutations except:
In the initiation phase of translation, the first component…
In the initiation phase of translation, the first component to attach to the mRNA is the:
After the event in the previous question, what will happen n…
After the event in the previous question, what will happen next?
What would happen, if anything, to the amino acid sequence i…
What would happen, if anything, to the amino acid sequence if there was an insertion of a T between nucleotides 13 and 14 in the DNA sequence? Here’s the DNA sequence again: 3’AAATTCACCTACATGGCGTTGCGCGAATGCTAGAATACCGCTCTCATTAGAAATCAAATC 5’
A gene is a:
A gene is a:
Which cell is in prophase?
Which cell is in prophase?
What happens when the ribosome reaches a stop codon?
What happens when the ribosome reaches a stop codon?
Monosaccharides are classified by the number of C atoms in t…
Monosaccharides are classified by the number of C atoms in their skeleton and the placement of which functional group?
Where is a capsule found in a bacterial cell?
Where is a capsule found in a bacterial cell?