A 63 year-old female presents to your clinic complaining of a hoarse vocal quality, resonance imbalance (i.e. hypernasality, nasal emissions) and difficulty swallowing. An oral mechanism examination reveals appropriate function of the masticatory, facial, and lingual muscles; however, you note markedly reduced soft palate elevation. E. List two instrumental assessment tools you could select to evaluate the swallowing function in this patient. List a pro and a con of each (2 pt). What are two specific deficits you might expect to see during this part of the evaluation given the limited case history (1 point).  

Materials move in and out of the nucleus through the __________.

What happens when the ribosome reaches a stop codon?

What structures are found within bacterial cells? 

In the animal life cycle _________ gametes fuse to form a _________ zygote.

All of the following are ways RNA differs from DNA except: 

Human height shows a continuous variation from the very short to the very tall. Height is most likely controlled by: 

The primers that DNA polymerase adds nucleotides to are made of:

After the event in the previous question, what will happen next?

Another BIOL 190 student transcribed the same DNA sequence above and gave an answer of: 5’UUUAAGUGGAUGUACCGCAACGCGCUUACGAUCUUAUGGCGAGAGUAAUCUUUAGUUUAG3’ Is this correct?