You are mapping three recessive autosomal linked genes in Drosphila: claret eye, curly wings and fluted  wings. You cross a triple heterozygous female to a homozygous claret, curly, fluted male and count the 1000 offspring with these results. Phenotype observed number fluted 4 claret 173 curled 26 fluted, claret 24 fluted, curled 167 claret, curled 6 fluted, claret, curled 298 wild type 302 Based on the information above (claret, curly, fluted cross) – what is the coefficient of coincidence?

Given the same template strand DNA sequence as before, what would be the effect (on the amino acid sequence) of a G to T substitution mutation at position #11 in the DNA sequence? 3′          GTTACTGAACGTCCTGGGACGCCATC              5′

How much buoyant force acts on a 12-ton ship sinking in a fresh-water lake?

When holes are drilled through the wall of a water tower, water will spurt out with the greatest speed from the hole closest to the _________

It is correct to say that impulse is equal to ____________  

If we triple the mass of an object without a change in volume, its density would be ________

Buoyant force is greatest on a submerged __________ (Note: Density of iron is higher than that of copper)

A flask brim filled with water is on a weighing scale. If you float a piece of wood in it, after spillage away from the scale, the scale reading will be ____________

Compared with an alcohol barometer, the column height for a mercury barometer would be __________

Degrees of freedom: