Materials move in and out of the nucleus through the __________.

What happens when the ribosome reaches a stop codon?

What structures are found within bacterial cells? 

In the animal life cycle _________ gametes fuse to form a _________ zygote.

All of the following are ways RNA differs from DNA except: 

Human height shows a continuous variation from the very short to the very tall. Height is most likely controlled by: 

The primers that DNA polymerase adds nucleotides to are made of:

After the event in the previous question, what will happen next?

Another BIOL 190 student transcribed the same DNA sequence above and gave an answer of: 5’UUUAAGUGGAUGUACCGCAACGCGCUUACGAUCUUAUGGCGAGAGUAAUCUUUAGUUUAG3’ Is this correct?

The trait of medium-sized leaves in iris is determined by the genetic condition PP’. Plants with large leaves are PP, while plants with small leaves are P’P’. A cross is made between two plants each with medium-sized leaves. They produce 80 seedlings. How would you describe the genotype of the plants with medium-sized leaves?