You have a rock with a volume of 15 x 10-6 m3 and a mass of 45 x 10-3 kg. What is its density?

Martha’s mother must have been sinistral:

What is the amplitude of the wave that is shown?

When gas in a container expands to three times its volume at constant temperature, the gas pressure ____________

To multiply an applied force while using a simple hydraulic lift, your force should be applied to the __________.

Monosomic:   

As a system becomes more disordered, entropy ___________    

Jason wants to convert 1.00 kg of water at 20.0 oC to steam at 100 oC.  How much heat (Q) in Joules, is required to complete this process? (Specific heat capacity of water is 4,190 J/kg oC and latent heat of vaporization of water is 2.25 x 106 J/kg )

You are mapping three recessive autosomal linked genes in Drosphila: claret eye, curly wings and fluted  wings. You cross a triple heterozygous female to a homozygous claret, curly, fluted male and count the 1000 offspring with these results. Phenotype observed number fluted 4 claret 173 curled 26 fluted, claret 24 fluted, curled 167 claret, curled 6 fluted, claret, curled 298 wild type 302 Based on the information above (claret, curly, fluted cross) – what is the coefficient of coincidence?

Given the same template strand DNA sequence as before, what would be the effect (on the amino acid sequence) of a G to T substitution mutation at position #11 in the DNA sequence? 3′          GTTACTGAACGTCCTGGGACGCCATC              5′