Skip to main navigationSkip to main contentSkip to footer
Wiki Cram
  • Home
  • Blog
Wiki Cram

Blog (page 36,728)

Given the same template strand DNA sequence as before, what…

Posted on: May 5, 2025 Last updated on: October 31, 2025 Written by: Anonymous
Given the same template strand DNA sequence as before, what would be the effect (on the amino acid sequence) of a G to T substitution mutation at position #11 in the DNA sequence? 3′          GTTACTGAACGTCCTGGGACGCCATC              5′
Continue reading “Given the same template strand DNA sequence as before, what…”…

How much buoyant force acts on a 12-ton ship sinking in a fr…

Posted on: May 5, 2025 Last updated on: May 5, 2025 Written by: Anonymous
How much buoyant force acts on a 12-ton ship sinking in a fresh-water lake?
Continue reading “How much buoyant force acts on a 12-ton ship sinking in a fr…”…

When holes are drilled through the wall of a water tower, wa…

Posted on: May 5, 2025 Last updated on: October 31, 2025 Written by: Anonymous
When holes are drilled through the wall of a water tower, water will spurt out with the greatest speed from the hole closest to the _________
Continue reading “When holes are drilled through the wall of a water tower, wa…”…

It is correct to say that impulse is equal to ____________  

Posted on: May 5, 2025 Last updated on: May 5, 2025 Written by: Anonymous
It is correct to say that impulse is equal to ____________  
Continue reading “It is correct to say that impulse is equal to ____________  ”…

If we triple the mass of an object without a change in volum…

Posted on: May 5, 2025 Last updated on: October 31, 2025 Written by: Anonymous
If we triple the mass of an object without a change in volume, its density would be ________
Continue reading “If we triple the mass of an object without a change in volum…”…

Buoyant force is greatest on a submerged __________ (Note: D…

Posted on: May 5, 2025 Last updated on: May 5, 2025 Written by: Anonymous
Buoyant force is greatest on a submerged __________ (Note: Density of iron is higher than that of copper)
Continue reading “Buoyant force is greatest on a submerged __________ (Note: D…”…

A flask brim filled with water is on a weighing scale. If yo…

Posted on: May 5, 2025 Last updated on: May 5, 2025 Written by: Anonymous
A flask brim filled with water is on a weighing scale. If you float a piece of wood in it, after spillage away from the scale, the scale reading will be ____________
Continue reading “A flask brim filled with water is on a weighing scale. If yo…”…

Compared with an alcohol barometer, the column height for a…

Posted on: May 5, 2025 Last updated on: October 31, 2025 Written by: Anonymous
Compared with an alcohol barometer, the column height for a mercury barometer would be __________
Continue reading “Compared with an alcohol barometer, the column height for a…”…

Degrees of freedom:

Posted on: May 5, 2025 Last updated on: May 5, 2025 Written by: Anonymous
Degrees of freedom:
Continue reading “Degrees of freedom:”…

According to Newton, the closer gravitationally interacting…

Posted on: May 5, 2025 Last updated on: October 31, 2025 Written by: Anonymous
According to Newton, the closer gravitationally interacting objects are to each other, the _____________    
Continue reading “According to Newton, the closer gravitationally interacting…”…
« Previous page 1 … 36,726 36,727 36,728 36,729 36,730 … 84,372 Next page »
Powered by Studyeffect
  • Privacy Policy
  • Terms of Service
Copyright © 2026 WIKI CRAM — Powered by NanoSpace