Which of the following are mechanisms of increasing cellular efficiency?

Chemicals that are known to cause mutations are called:

During translation, ______ is  produced from the information in ______.

Which of the following substances would be able to diffuse across a cell membrane on its own?

If inheritance occurred through a blending mechanism, what would happen to variation in populations?    

The form of chromatin seen in chromosomes during mitosis.

Another BIOL 190 student transcribed the same DNA sequence above and gave an answer of: 5’UUUAAGUGGAUGUACCGCAACGCGCUUACGAUCUUAUGGCGAGAGUAAUCUUUAGUUUAG3’ Is this correct?

The Public Health Nurse has a visit planned to a developing nation. The nurse knows it is best to approach this community in which way?

What enzyme removes primers from the new strand of DNA?

Cells with active telomerase are capable of what feat?