Use the table below to transcribe and translate the following DNA sequence and identify the final polypeptide strand. DNA: 3′ – TACGGGGGTCCCTTGGCA – 5′

What is the relationship between the terms “genotype” and “phenotype”?

You have identified the mutation in a p53 gene responsible for an aggressive type of lung cancer. The mutation is highlighted in red and underlined in the DNA sequence data below. What type of mutation is it? What change does the mutation cause? Normal p53 Sequence: 3′ – AATGCACAACCATTCCCA – 5’Mutant p53 Sequence: 3′ – AATGCACAACCATCCCCA – 5′

Which of the following makes the sentence FALSE? “You should avoid smoking in order to…”

Which phylogeny is best supported by the DNA sequence similarity data in the table below? birds crocodilians lepidosaurs (lizards) turtles mammals birds 100% crocodilians 88% 100% lepidosaurs (lizards) 72% 71% 100% turtles 70% 72% 91% 100% mammals 60% 58% 60% 59% 100% Hint: Compare all of the DNA similarities.  

You are studying three newly discovered butterfly species found in a remote, isolated part of the Amazon. To determine how they are related to the more common butterfly species found throughout the Amazon,  you collect and sequence a DNA sample from each species. Below are the results, shown as a single strand of DNA for each species. Common butterfly: GGATCCAGATCTGTCGGAGTNew species 1: GGACGCAGATCATTAGGACTNew species 2: GGATCGAGATCTGTCGAACTNew species 3: GGACCCAGATCAGTAGGACT Based on these data, what species is most closely related to the common butterfly species?

To make copies of specific DNA sequences in the lab, scientists use polymerase chain reaction (PCR). During PCR, heat is used to “unzip” the two strands that comprise the DNA molecule. PCR mimics DNA replication in some ways, but not in how the two strands are pulled apart. How are the two strands of DNA unzipped during DNA replication in the cell? 

Which of the following processes generates new genetic variation in a population?

A mutation in a single gene in mice leads to a wide range of effects, including changes in fur color, bone structure, and immune function. This phenomenon, where one gene influences multiple traits, is known as:

Each messenger RNA (mRNA) codon corresponds to…