Which of the following are mechanisms of increasing cellular efficiency?

A different BIOL 190 student transcribed the same DNA sequence above and gave an answer of: 5’GAUUUGAUUUCUAAUGAGAGCGGUAUUCUAGCAUUCGCGCAACGCCAUGUAGGUGAAUUU 3’ Is this correct?

Chemicals that are known to cause mutations are called:

When Mendel crossed tall plants with dwarf plants, he made sure to cross pollen from a tall plant with ova from a dwarf plant and pollen from a dwarf plant with ova from a tall plant.  What type of cross is this?

The nucleus of an atom is composed of two subatomic particles, ______________ and _____________. 

All cells in a multicellular organism contain the same genes.

In nucleotide excision repair, how is damaged DNA removed?

A different BIOL 190 student transcribed the same DNA sequence above and gave an answer of: 5’GAUUUGAUUUCUAAUGAGAGCGGUAUUCUAGCAUUCGCGCAACGCCAUGUAGGUGAAUUU 3’ Is this correct?

The events of the last four questions will continue until what happens?

During translation, ______ is  produced from the information in ______.