Hershey and Chase conducted experiments using radioactive is…

Hershey and Chase conducted experiments using radioactive isotopes to label DNA and protein in separate bacteriophage cultures and track if each molecule was transferred into infected cells with the genetic material of the phage.  Upon removal of bacteriophage coats from infected bacterial cells, where was the label for the DNA? What isoptope was used to label the DNA?

Assume a DNA molecular, with the primary structure listed be…

Assume a DNA molecular, with the primary structure listed below, has the expected secondary structure for biological DNA in a cell.  In this double stranded DNA molecule, there are 11 Ts, 12 Cs, 12 Gs, and 11 As.  How many purines are present? ​ 5’AATAGCGGATGCCCGAATACGAG 3’TTATCGCCTACGGGCTTATGCTC

You learn that a Mars lander has retrieved a bacterial sampl…

You learn that a Mars lander has retrieved a bacterial sample from the polar ice caps. You obtain a sample of these bacteria and perform the same kind of experiment that Meselson and Stahl did to determine how the Mars bacteria replicate their DNA. Based on the following equilibrium density gradient centrifugation results, what type of replication would you propose for these new bacteria?