A single-stranded sequence of a gene is given below. Two parts of the sequence are delimited by ‘/’, which encompass the sites where PCR primers anneal. Which sequences shown below correspond to PCR primers that would amplify this gene region?  SELECT ALL THAT APPLY.

Welcome to exam 2.  Take a deep breath, this will be ok! Have a sheet of blank paper and a simple calculator. If you have questions during the exam you can write the question on your paper and do the rest of the questions first. Your instructors will be available.  Note: DO NOT submit your exam if you want to come back to it after you ask a question. If you switch tabs it will likely bump you out of the exam, but you will be allowed back in (as long as you haven’t hit “submit”). If you intend to use a blank sheet of paper or a white board please show both sides of it to your camera now.

Genes that are expressed at all times at relatively constant levels over time and in different tissues are known as ___ genes.

Mark all of the following statements that are true for asexual organisms.

Welcome to exam 2.  Take a deep breath, this will be ok! Have a sheet of blank paper and a simple calculator. If you have questions during the exam you can write the question on your paper and do the rest of the questions first. Your instructors will be available.  Note: DO NOT submit your exam if you want to come back to it after you ask a question. If you switch tabs it will likely bump you out of the exam, but you will be allowed back in (as long as you haven’t hit “submit”). If you intend to use a blank sheet of paper or a white board please show both sides of it to your camera now.

In molecular biology, palindrome refers to a sequence such as which of the following? (Note: only the 5′ to 3′ strand is shown; each has an implied complementary strand 3′ to 5′, not shown here)

Part 2: Review Questions from Weeks 1-8

By signing my name below I attest that I have not received nor given help on this exam to anyone else. Nor have I used resources outside of my own brain on this exam.

What would result from a single nucleotide deletion (point mutation) in the middle of the coding sequence of a structural gene?

Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide?   Normal gene: ATGGCCGGCCCGAAAGAGACC          Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr          Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp