For the following Free response consider this the template strand: 5′ CTTAGAGTCCTCAGTCCACGTGCATGT 3′
What is the sequence of the coding strand? (2pts) Label the…
What is the sequence of the coding strand? (2pts) Label the 5′ and 3′ end. If you do not, I will assume your answer is oriented 5′ –> 3 ‘
The phase in aerobic respiration where electrons are removed…
The phase in aerobic respiration where electrons are removed from electrons carries, passed through a series of enzymes that move H+ out of the matrix, then placed onto oxygen is called
I’m currently writing this test during the COVID-19 outbreak…
I’m currently writing this test during the COVID-19 outbreak of 2020. COVID-19 is the disease caused by the SARS-CoV-2 virus. Like all virus in the coronavirus family of viruses, SARS-CoV-2 is an RNA virus; it stores it’s genetic information as DNA instead of RNA. To complete it’s life cycle, the virus needs a method of copying it’s RNA genome. For this, it requires an RNA-dependent RNA polymerase. Cellular organisms (all prokaryotes and eukaryotes) have DNA dependent RNA polymerases. Because human cells do not have RNA-dependent RNA polymerases, this presents a potential target for drug therapies. A compound remdesivir is a nucleotide analog and targets RNA-dependent RNA polymerases. Specifically it becomes incorporated into the growing strand of RNA, but prevents elongation. As of the writing of this question, remdesivir is being investigated as a potential treatment for COVID-19. Early studies have shown a 30% reduction in recovery time for those patients treated with Remdesivir versus placebo. Further studies are of course necessary prior to approval to further demonstrate safety and efficacy, I don’t actually have a question here, but knew that I had your attention and I wanted to use the opportunity to show you how abstract concepts like RNA synthesis related to the world around you. For credit choose A from the list of answers
Have a good break (select “this is the correct answer” for a…
Have a good break (select “this is the correct answer” for a free point).
If the allele for tall plants were dominant to short plans,…
If the allele for tall plants were dominant to short plans, how would best represent the genotype of a plant homozygous recessive for plant height
By which process do prokaryotic cells divide to produce two…
By which process do prokaryotic cells divide to produce two identical daughter cells?
list the 3 bio molecules that are polymers, next to each, gi…
list the 3 bio molecules that are polymers, next to each, give the monomer it is made of (1/2 point each) and describe the structure of the monomer (1pt each)
A sex cell that results from meiosis in called a
A sex cell that results from meiosis in called a
What are the components of a phospholipid?
What are the components of a phospholipid?