Skip to main navigationSkip to main contentSkip to footer
Wiki Cram
  • Home
  • Blog
Wiki Cram

Blog (page 38,295)

What would happen, if anything, to the amino acid sequence i…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
What would happen, if anything, to the amino acid sequence if there was an insertion of a T between nucleotides 13 and 14 in the DNA sequence? Here’s the DNA sequence again: 3’AAATTCACCTACATGGCGTTGCGCGAATGCTAGAATACCGCTCTCATTAGAAATCAAATC 5’
Continue reading “What would happen, if anything, to the amino acid sequence i…”…

A person with the Bombay phenotype will appear to have which…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
A person with the Bombay phenotype will appear to have which blood type?
Continue reading “A person with the Bombay phenotype will appear to have which…”…

All cells in a multicellular organism express the same genes…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
All cells in a multicellular organism express the same genes.
Continue reading “All cells in a multicellular organism express the same genes…”…

The primary growth phase of the cell following division.

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
The primary growth phase of the cell following division.
Continue reading “The primary growth phase of the cell following division.”…

Which of the following are mechanisms of increasing cellular…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
Which of the following are mechanisms of increasing cellular efficiency?
Continue reading “Which of the following are mechanisms of increasing cellular…”…

A different BIOL 190 student transcribed the same DNA sequen…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
A different BIOL 190 student transcribed the same DNA sequence above and gave an answer of: 5’GAUUUGAUUUCUAAUGAGAGCGGUAUUCUAGCAUUCGCGCAACGCCAUGUAGGUGAAUUU 3’ Is this correct?
Continue reading “A different BIOL 190 student transcribed the same DNA sequen…”…

Chemicals that are known to cause mutations are called:

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
Chemicals that are known to cause mutations are called:
Continue reading “Chemicals that are known to cause mutations are called:”…

When Mendel crossed tall plants with dwarf plants, he made s…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
When Mendel crossed tall plants with dwarf plants, he made sure to cross pollen from a tall plant with ova from a dwarf plant and pollen from a dwarf plant with ova from a tall plant.  What type of cross is this?
Continue reading “When Mendel crossed tall plants with dwarf plants, he made s…”…

The nucleus of an atom is composed of two subatomic particle…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
The nucleus of an atom is composed of two subatomic particles, ______________ and _____________. 
Continue reading “The nucleus of an atom is composed of two subatomic particle…”…

All cells in a multicellular organism contain the same genes…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
All cells in a multicellular organism contain the same genes.
Continue reading “All cells in a multicellular organism contain the same genes…”…
« Previous page 1 … 38,293 38,294 38,295 38,296 38,297 … 90,121 Next page »
Powered by Studyeffect
  • Privacy Policy
  • Terms of Service
Copyright © 2026 WIKI CRAM — Powered by NanoSpace