Skip to main navigationSkip to main contentSkip to footer
Wiki Cram
  • Home
  • Blog
Wiki Cram

Blog (page 38,546)

 What cranial nerves are involved in completion of a swallow…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
 What cranial nerves are involved in completion of a swallow?
Continue reading “ What cranial nerves are involved in completion of a swallow…”…

In an XX mammal, which X chromosome will be inactivated?

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
In an XX mammal, which X chromosome will be inactivated?
Continue reading “In an XX mammal, which X chromosome will be inactivated?”…

Contraction of the posterior cricoarytenoid (PCA) muscle res…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
Contraction of the posterior cricoarytenoid (PCA) muscle results in abduction of the vocal folds; innervation to the PCA is provided by the recurrent laryngeal branch of CN X.
Continue reading “Contraction of the posterior cricoarytenoid (PCA) muscle res…”…

The nucleus of an atom is composed of two subatomic particle…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
The nucleus of an atom is composed of two subatomic particles, ______________ and _____________. 
Continue reading “The nucleus of an atom is composed of two subatomic particle…”…

What property of water is NOT attributable to hydrogen bondi…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
What property of water is NOT attributable to hydrogen bonding between water molecules? 
Continue reading “What property of water is NOT attributable to hydrogen bondi…”…

When a cell in the human body ruptures, the immune system re…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
When a cell in the human body ruptures, the immune system responds with inflammation. Which component of the ruptured cell elicits this response?
Continue reading “When a cell in the human body ruptures, the immune system re…”…

When water freezes into a solid, it’s molecules are packed t…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
When water freezes into a solid, it’s molecules are packed together ________ densely than in a liquid state.
Continue reading “When water freezes into a solid, it’s molecules are packed t…”…

The lagging strand of DNA is built in pieces called:

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
The lagging strand of DNA is built in pieces called:
Continue reading “The lagging strand of DNA is built in pieces called:”…

A different BIOL 190 student transcribed the same DNA sequen…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
A different BIOL 190 student transcribed the same DNA sequence above and gave an answer of: 5’GAUUUGAUUUCUAAUGAGAGCGGUAUUCUAGCAUUCGCGCAACGCCAUGUAGGUGAAUUU 3’ Is this correct?
Continue reading “A different BIOL 190 student transcribed the same DNA sequen…”…

A tightly wound nucleosome is not available for transcriptio…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous
A tightly wound nucleosome is not available for transcription.
Continue reading “A tightly wound nucleosome is not available for transcriptio…”…
« Previous page 1 … 38,544 38,545 38,546 38,547 38,548 … 90,384 Next page »
Powered by Studyeffect
  • Privacy Policy
  • Terms of Service
Copyright © 2026 WIKI CRAM — Powered by NanoSpace