Essay B. Evolutionary trees, or phylogenies, are diagrams depicting relationships between a set of organisms or clades.  In common language explain how researchers can use nodes to determine how closely related organisms are to each other. In your explanation, please include 3 parts: (a) what does a node represents biologically? (b) how is time oriented on a phylogeny (i.e., where is deep time and where is more recent time)? and (c) what does the position of nodes (i.e., closer to the tips vs. closer to the base of the tree) mean in terms of relatedness of two species?  

What would result from a single nucleotide deletion (point mutation) in the middle of the coding sequence of a structural gene?

Use the following character matrix to build a phylogeny and then answer the following question about the tree you built. Question: Species 2 is most closely related to which of the following species (You might mark more than one response):   Trait A Trait B Trait C Trait D Trait E Trait F Trait G Species 1 0 0 1 0 0 1 0 Species 2 0 0 1 1 0 0 1 Species 3 1 1 1 0 0 0 1 Species 4 1 1 1 0 0 0 1 Species 5 1 0 1 0 1 0 1 Species 6 1 0 1 0 1 0 1 Outgroup 0 0 0 0 0 0 0

Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide?   Normal gene: ATGGCCGGCCCGAAAGAGACC          Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr          Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp

 The sequence of amino acids in a protein is its________ structure.

Which of the following statements about sex in a biological context are not true:

Which of the following is considered to be a ‘scientist stereotype’?

You insert a fragment of sheep DNA into a plasmid containing an AmpR gene. You transform bacteria with the recombinant plasmid, and plate the cells on growth media containing the antibiotic ampicillin. Each colony on the plate arose from ________ that ________ to ampicillin.

Which of the following is considered to be a ‘scientist stereotype’?

Essay C. In class, we used the idea of levels of selection to explore why microbes make us sick, but do not kill us.   Using the concepts of relative fitness, levels of selection, and strength of selection at each level, explain why viruses and bacteria commonly do not have such high virulence that they kill their host.  In your explanation include four parts: (a) what trait was under selection, (b) the levels of selection involved, (c) how selection was acting on the trait at each level, and (d) the outcome for the trait overall from the interaction between selection at the different levels.   (We also discussed how hosts can adapt to diseases, but don’t worry about that aspect for this answer)