Here is your exam.  When you are finished, use your camera to scan your exam and upload it here.  Exam 1 file

CHOOSE THE BEST ANSWER A mother and her two daughters each develop ovarian cancer at approximately the same age in their lives. Based on genetic analysis, it is determined that mutations in the BRCA1,  tumor suppressor gene, is responsible for all three instances of cancer. Their specific mutations are presented below (bold base pair). Mother: ATCGTGTCCADaughter A: ATCGTGTCCADaughter B: ATAGTCTCCA Given these data, what is the most likely origin of each daughter’s cancer? Daughter A’s cancer is Daughter B’s cancer is

CHOOSE THE BEST ANSWER Which of the following correctly displays the Central Dogma of Biology?

TRUE OR FALSE Gaucher Disease is an autosomal recessive disease. A woman has a child with Gaucher Disease, but she is unsure who the father is. One possible father has Gaucher Disease and the other does not. Based on this information, can the woman be 100% certain who the father is?

CHOOSE THE BEST ANSWER The genetic code is said to be redundant but unambiguous. Which of the following best supports this statement?

CHOOSE THE BEST ANSWER The HER2 gene is a proto-oncogene that regulates the cell cycle. Mutations in HER2 are associated with the development of breast cancer.  As a proto-oncogene, how do you expect mutations in HER2 to disrupt the cell cycle?

CHOOSE THE BEST ANSWER Great jerboas and Severtzov’s jerboas are both small rodents native to arid regions, and they look nearly identical to each other. You sequence one gene present in both species, as well as the same gene in the Four-toed jerboa and the Lesser fat-tailed jerboa. You obtain the following results: Great jerboa:   GGATCCAGATCTGTCGAACTFour-toed jerboa:     GGATCGAGATCTGTGCAACTLesser fat-tailed jerboa: GGATCCAGATCGTTGGAAGTSevertzov’s jerboa: GGATCCAGATCTGTCGAGCT Based on the data, which species is most closely related to the Great jerboa?

CHOOSE THE BEST ANSWER Use the table below to transcribe and translate the following DNA sequence and identify the final polypeptide strand. DNA: 3′ – TTGGGACCACGGAACCGT – 5′

CHOOSE THE BEST ANSWER Foxes The Arctic fox (Vulpes lagopus) and the fennec fox (Vulpes zerda) both belong to the same genus but inhabit vastly different environments—one in the Arctic and the other in the Sahara desert. On the other hand, the Corsac fox (Vulpes corsac) and the Cape fox (Vulpes chama) live in semi-arid habitats in Central Asia and South Africa, respectively. You sequence one gene present in all four species and obtain the following results: Arctic fox: TCGGATCAGGACTACCTAGACape fox: TTGGGTGAGGATTGCGTATACorsac fox: TCGGATCAGGACTACTTAAAFennec fox: TTGGGTGAGGATCGCATATT Based on the data, which species is most closely related to the Arctic fox?

CHOOSE THE BEST ANSWER FOR EACH OPTION When one DNA molecule is replicated, the resulting two DNA molecules contain . This outcome results from the fact that the process of DNA replication is .