Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide?   Normal gene: ATGGCCGGCCCGAAAGAGACC          Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr          Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp

 The sequence of amino acids in a protein is its________ structure.

Which of the following statements about sex in a biological context are not true:

Which of the following is considered to be a ‘scientist stereotype’?

You insert a fragment of sheep DNA into a plasmid containing an AmpR gene. You transform bacteria with the recombinant plasmid, and plate the cells on growth media containing the antibiotic ampicillin. Each colony on the plate arose from ________ that ________ to ampicillin.

Which of the following is considered to be a ‘scientist stereotype’?

Essay C. In class, we used the idea of levels of selection to explore why microbes make us sick, but do not kill us.   Using the concepts of relative fitness, levels of selection, and strength of selection at each level, explain why viruses and bacteria commonly do not have such high virulence that they kill their host.  In your explanation include four parts: (a) what trait was under selection, (b) the levels of selection involved, (c) how selection was acting on the trait at each level, and (d) the outcome for the trait overall from the interaction between selection at the different levels.   (We also discussed how hosts can adapt to diseases, but don’t worry about that aspect for this answer)

Which of the following statements about sex in a biological context are not true:

 A Facebook news story declares that eating chocolate increases the risk of bladder cancers.  You click on the article and find that it cites a study where rats who consumed more chocolate had an increased risk of cancer depending on how much they consumed.  Rats who consumed the most had a high risk for bladder cancer whereas rats who did not consume chocolate had an extremely low risk of bladder cancer.  Cancer only developed after chocolate was consumed. What can you conclude from this study?

In a species of salamander, Plethodon hermani, females are more likely to mate with males who have red legs than males with dull legs.  Males are more likely to mate with females who have larger abdomens.  Females have evolved air sacs that they inflate to make their abdomens look bigger.   Both redness of legs and air sacs are heritable.