CHOOSE THE BEST ANSWER Foxes The Arctic fox (Vulpes lagopus)…
CHOOSE THE BEST ANSWER Foxes The Arctic fox (Vulpes lagopus) and the fennec fox (Vulpes zerda) both belong to the same genus but inhabit vastly different environments—one in the Arctic and the other in the Sahara desert. On the other hand, the Corsac fox (Vulpes corsac) and the Cape fox (Vulpes chama) live in semi-arid habitats in Central Asia and South Africa, respectively. You sequence one gene present in all four species and obtain the following results: Arctic fox: TCGGATCAGGACTACCTAGACape fox: TTGGGTGAGGATTGCGTATACorsac fox: TCGGATCAGGACTACTTAAAFennec fox: TTGGGTGAGGATCGCATATT Based on the data, which species is most closely related to the Arctic fox?