Skip to main navigationSkip to main contentSkip to footer
Wiki Cram
  • Home
  • Blog
Wiki Cram

What would happen, if anything, to the amino acid sequence i…

What would happen, if anything, to the amino acid sequence if there was an insertion of a T between nucleotides 13 and 14 in the DNA sequence? Here’s the DNA sequence again: 3’AAATTCACCTACATGGCGTTGCGCGAATGCTAGAATACCGCTCTCATTAGAAATCAAATC 5’

What would happen, if anything, to the amino acid sequence i…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous Categorized in: Uncategorized
Skip back to main navigation
Powered by Studyeffect

Post navigation

Previous Post Which of the following is NOT part of a bedside clinical swa…
Next Post Identical copies of a chromosome.
  • Privacy Policy
  • Terms of Service
Copyright © 2026 WIKI CRAM — Powered by NanoSpace