Skip to main navigationSkip to main contentSkip to footer
Wiki Cram
  • Home
  • Blog
Wiki Cram

Another BIOL 190 student transcribed the same DNA sequence a…

Another BIOL 190 student transcribed the same DNA sequence above and gave an answer of: 5’UUUAAGUGGAUGUACCGCAACGCGCUUACGAUCUUAUGGCGAGAGUAAUCUUUAGUUUAG3’ Is this correct?

Another BIOL 190 student transcribed the same DNA sequence a…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous Categorized in: Uncategorized
Skip back to main navigation
Powered by Studyeffect

Post navigation

Previous Post What enzyme removes primers from the new strand of DNA?
Next Post The form of chromatin seen in chromosomes during mitosis.
  • Privacy Policy
  • Terms of Service
Copyright © 2025 WIKI CRAM — Powered by NanoSpace