Cells with active telomerase are capable of what feat?

After correctly transcribing the DNA sequence above, another BIOL 190 student then translated the resulting mRNA and gave the following answer: phenylalanine, lysine, tryptophan, methionine, tyrosine, arginine, asparagine, alanine, leucine, threonine, isoleucine, leucine, tryptophan, arginine, glutamate Is this correct?

In co-transport, the ___________ of a diffusing molecule is used to power the __________ of another molecule.

Identical copies of a chromosome.

What would happen, if anything, to the amino acid sequence if there was an insertion of a T between nucleotides 13 and 14 in the DNA sequence? Here’s the DNA sequence again: 3’AAATTCACCTACATGGCGTTGCGCGAATGCTAGAATACCGCTCTCATTAGAAATCAAATC 5’

How does an allosteric activator affect an enzyme?

Which of the following is NOT part of a bedside clinical swallowing evaluation:

Objects that are moving are said to possess: 

Select the correct order of muscular composition:

DNA polymerase can only add nucleotides to the free 3’ OH of another nucleotide.