During which phase of mitosis are the chromosomes uncoiling, the nuclear envelope reforming and the spindle apparatus breaking down?

During  eukaryotic mRNA processing are removed and leaving only the . 

What is the function of DNA Ligase?

For the following Free response consider this the template strand: 5′ CTTAGAGTCCTCAGTCCACGTGCATGT 3′

What is the sequence of the coding strand? (2pts) Label the 5′ and 3′ end. If you do not, I will assume your answer is oriented 5′ –> 3 ‘

The phase in aerobic respiration where electrons are removed from electrons carries, passed through a series of enzymes that move H+ out of the matrix, then placed onto oxygen is called

I’m currently writing this test during the COVID-19 outbreak of 2020. COVID-19 is the disease caused by the SARS-CoV-2 virus. Like all virus in the coronavirus family of viruses, SARS-CoV-2 is an RNA  virus; it stores it’s genetic information as DNA instead of RNA. To complete it’s life cycle, the virus needs a  method of copying it’s RNA genome. For this, it requires an RNA-dependent RNA polymerase. Cellular organisms (all prokaryotes and eukaryotes) have DNA dependent RNA polymerases. Because human cells do not have RNA-dependent RNA polymerases, this presents a potential target for drug therapies. A compound remdesivir is a nucleotide analog and targets RNA-dependent RNA polymerases. Specifically it becomes incorporated into the growing strand of RNA, but prevents elongation. As of the writing of this question, remdesivir is being investigated as a potential treatment for COVID-19.  Early studies have shown a  30% reduction in recovery time for those patients treated with Remdesivir  versus placebo. Further studies are of course necessary prior to approval to further demonstrate safety  and efficacy, I don’t actually have a question here, but knew that I had your attention and I wanted to use the opportunity to show you how abstract concepts like RNA synthesis related to the world around you. For  credit  choose A from the list of answers

Have a good break (select “this is the correct answer” for a free point).

If the allele for tall plants were dominant to short plans, how would best represent the genotype of a plant homozygous recessive for  plant height

By which process do prokaryotic cells divide to produce two identical daughter cells?