What would happen, if anything, to the amino acid sequence if there was an insertion of a T between nucleotides 13 and 14 in the DNA sequence? Here’s the DNA sequence again: 3’AAATTCACCTACATGGCGTTGCGCGAATGCTAGAATACCGCTCTCATTAGAAATCAAATC 5’
A gene is a:
A gene is a:
Which cell is in prophase?
Which cell is in prophase?
What happens when the ribosome reaches a stop codon?
What happens when the ribosome reaches a stop codon?
Monosaccharides are classified by the number of C atoms in t…
Monosaccharides are classified by the number of C atoms in their skeleton and the placement of which functional group?
Where is a capsule found in a bacterial cell?
Where is a capsule found in a bacterial cell?
The second tRNA to attach to the mRNA will occupy the ______…
The second tRNA to attach to the mRNA will occupy the __________ of the ribosome.
The lagging strand of DNA is built in pieces called:
The lagging strand of DNA is built in pieces called:
A tightly wound nucleosome is not available for transcriptio…
A tightly wound nucleosome is not available for transcription.
The function of primase.
The function of primase.