DNA polymerase can only add nucleotides to the free 3’ OH of another nucleotide.
In building the lagging strand, what enzyme joins the Okaza…
In building the lagging strand, what enzyme joins the Okazaki fragments?
The failure of chromosomes to separate normally during meios…
The failure of chromosomes to separate normally during meiosis is called:
During which stage of mitosis do replicated chromosomes cond…
During which stage of mitosis do replicated chromosomes condense and the nuclear envelope disappears?
Proteins called ________ are required to trigger a cell to m…
Proteins called ________ are required to trigger a cell to move past the G1 and G2 checkpoints.
What would happen, if anything, to the amino acid sequence i…
What would happen, if anything, to the amino acid sequence if there was an insertion of a T between nucleotides 13 and 14 in the DNA sequence? Here’s the DNA sequence again: 3’AAATTCACCTACATGGCGTTGCGCGAATGCTAGAATACCGCTCTCATTAGAAATCAAATC 5’
A person with the Bombay phenotype will appear to have which…
A person with the Bombay phenotype will appear to have which blood type?
All cells in a multicellular organism express the same genes…
All cells in a multicellular organism express the same genes.
The primary growth phase of the cell following division.
The primary growth phase of the cell following division.
Which of the following are mechanisms of increasing cellular…
Which of the following are mechanisms of increasing cellular efficiency?