Given the following DNA sequence below provide the sequence for the complementary strand that would synthesized when replicating this DNA:5’  CCCGATTGCATACCGAAATGC 3’ Give just the CAPITAL letters  not the 5′ or 3′ part–NO SPACES

Explain why some people are lactose intolerant. (your answer should explain what molecular feature of lactose causes the intolerance)

Which molecule shown above contains an amino functional group, but is NOT an amino acid?

What is the maximum number of hydrogen bonds a water molecule can form with neighboring water molecules?

The nurse practitioner is evaluating a client for the chief complaint of “sore throat”. In which suspected diagnosis would a throat culture be indicated? 

The nurse practitioner is evaluating a 10-year-old boy in the clinic. The child’s parent reports he complained of sudden onset of scrotal pain upon awakening earlier that morning. His symptoms are accompanied by severe nausea and vomiting. During the physical examination, the nurse practitioner finds a tender, warm, and swollen left scrotum. The cremasteric reflex is negative and the urine dipstick is negative for leukocytes, nitrites, and blood.  What diagnosis does the NP suspect? 

During a breast exam of a 25-year-old nulliparous woman, the nurse practitioner palpates several slightly tender, rubbery mobile areas of breast tissue. Both breasts have symmetrical findings. There are no skin changes or any nipple discharge. The patient is expecting her menstrual period in 5 days. Which action by the NP would recommend?

The nurse practitioner is evaluating a 12-year old female for the complaint of “I get clogged up and start wheezing when I play soccer”. What is the gold standard for diagnosing asthma?

The nurse practitioner is seeing a client who has recently started taking oral contraceptives. As the client’s age, dose, and length of therapy increase, the NP knows that there may be an increased risk for which of the following conditions?

Using Nagele’s rule, what would be the estimated date of delivery (EDD) for a pregnant woman with a LMP of November 20, 2108?