What type of bonds does DNA ligase create between adjacent nucleotides?

Alterations of chromatin of DNA structure that are stable and inheritable in offspring via DNA methylation or alteration of histone proteins are referred to as _____ changes.

What is the RNA sequence transcribed from the DNA shown below?  

For a given gene, both strands of a DNA are used as a template simultaneously from one initiation point when which of the following molecules is synthesized?

Which of the following molecules is synthesized using nucleotides containing the bases adenine, guanine, cytosine, and uracil?

Meier-Gorlin syndrome results from flaws in the licensing of origins in replication. Which is the most likely effect on DNA replication in effected individuals?

A key modification in the 3 end of eukaryotic mRNA is the addition of 50 to 250 adenine nucleotides, forming a poly(A) tail. Which of the following is NOT a function of the poly(A) tail?

Prokaryotic promoters contain the sequence TATAAT at a position _____ from the transcription start.

Assume a DNA molecular, with the primary structure listed below, has the expected secondary structure for biological DNA in a cell.  In this double stranded DNA molecule, how many 3´ hydroxyls are present? ​ 5’AATAGCGGATGCCCGAATACGAG 3’TTATCGCCTACGGGCTTATGCTC

What types of bonds are created between adjacent ribonucleotides during the process of transcription?