Red-green color blindness in humans is inherited as a recess…

Red-green color blindness in humans is inherited as a recessive X-linked trait. The allele for normal vision is B, and the allele for colorblindness is b.  A husband and wife have 4 sons and 2 daughters. All 4 sons are color-blind, but none of the daughters are color-blind. What are the most likely genotypes of the parents?

Gaucher Disease is caused by an autosomal recessive allele….

Gaucher Disease is caused by an autosomal recessive allele. A woman has a child with Gaucher Disease, but she is uncertain who the father is. One of the possible fathers has Gaucher Disease. The other possible father does not have the disease. Based on this information, the woman can identify which of these two men is her child’s father with 100% certainty. True or false?

You have identified the mutation in a p53 gene responsible f…

You have identified the mutation in a p53 gene responsible for an aggressive type of lung cancer. The mutation is highlighted in red and underlined in the DNA sequence data below. What type of mutation is it? What change does the mutation cause? Normal p53 Sequence: 3′ – AATGCACAACCATTCCCA – 5’Mutant p53 Sequence: 3′ – AATGCACAACCATCCCCA – 5′

Which phylogeny is best supported by the DNA sequence simila…

Which phylogeny is best supported by the DNA sequence similarity data in the table below? birds crocodilians lepidosaurs (lizards) turtles mammals birds 100% crocodilians 88% 100% lepidosaurs (lizards) 72% 71% 100% turtles 70% 72% 91% 100% mammals 60% 58% 60% 59% 100% Hint: Compare all of the DNA similarities.  

You are studying three newly discovered butterfly species fo…

You are studying three newly discovered butterfly species found in a remote, isolated part of the Amazon. To determine how they are related to the more common butterfly species found throughout the Amazon,  you collect and sequence a DNA sample from each species. Below are the results, shown as a single strand of DNA for each species. Common butterfly: GGATCCAGATCTGTCGGAGTNew species 1: GGACGCAGATCATTAGGACTNew species 2: GGATCGAGATCTGTCGAACTNew species 3: GGACCCAGATCAGTAGGACT Based on these data, what species is most closely related to the common butterfly species?