One of these representations of DNA structure is best because it possesses the most correct elements while all the others have at least one fatal flaw. Which image is the best schematic representation of DNA?
In meiosis, what is meant by independent assortment? When do…
In meiosis, what is meant by independent assortment? When do alleles sort independently and when do they sort non-independently? (2-3 sentences)
Identify ALL of the alpha carbons.
Identify ALL of the alpha carbons.
There are 5 sections of this exam with 30 questions total. …
There are 5 sections of this exam with 30 questions total. Please ask questions of your instructors if needed. No other outside help (neighbors, notes, online resources) is allowed. Do your best. You’ve got this.
In the cDNA synthesis process, after degrading the mRNA stra…
In the cDNA synthesis process, after degrading the mRNA strands that are base paired with the first strands of DNA, you synthesize the second strand of DNA (to make double stranded DNA). Using the resulting complex pool of double stranded DNA (that you’ve made) as template you carry out PCR with primers shown below with the goal of amplifying just one specific part of the human oxytocin/neurophysin gene, also shown below. >Human Oxytocin/Neurophysin cDNA (5’UTR: 36nt; CDS: 378nt; 3’UTR: 94nt) ACCAGTCACGGACCCTGGACCCAGCGCACCCGCACCATGGCCGGCCCCAGCCTCGCTTGCTGTCTGCTCGGCCTCCTGGCGCTGACCTC CGCCTGCTACATCCAGAACTGCCCCCTGGGAGGCAAGAGGGCCGCGCCGGACCTCGACGTGCGCAAGTGCCTCCCCTGCGGCCCCGGGG GCAAAGGCCGCTGCTTCGGGCCCAATATCTGCTGCGCGGAAGAGCTGGGCTGCTTCGTGGGCACCGCCGAAGCGCTGCGCTGCCAGGAG GAGAACTACCTGCCGTCGCCCTGCCAGTCCGGCCAGAAGGCGTGCGGGAGCGGGGGCCGCTGCGCGGTCTTGGGCCTCTGCTGCAGCCC GGACGGCTGCCACGCCGACCCTGCCTGCGACGCGGAAGCCACCTTCTCCCAGCGCTGAAACTTGATGGCTCCGAACACCCTCGAAGCGC GCCACTCGCTTCCCCCATAGCCACCCCAGAAATGGTGAAAATAAAATAAAGCAGGTTTTTCTCCTCTAAAAAAAAAAAAAAAAAAAAAA Figure 1. The human oxytocin-neurophysin mRNA (cDNA) sequence. Start codon is bolded. Stop codon is bolded. Forward primer 5’ AAGCTTATGGCCGGCCCCAGCCTCGC (with added HindIII linker) Reverse primer 5’ GAATTCTCAGCGCTGGGAGAAGGTGG (with added EcoRI linker) Figure 2. The primers used in the polymerase chain reaction. Target-matching section of the primer is underlined. The added recognition sequence and and cut site for one of two restriction enzymes is shown in italics. What human genetic information would this polymerase chain reaction amplify?
Which practice best supports maintaining sterility after ste…
Which practice best supports maintaining sterility after sterilization?
Approved marking pens must be:
Approved marking pens must be:
What is the main purpose of tip protectors on surgical instr…
What is the main purpose of tip protectors on surgical instruments?
What is the purpose of tamper-evident seals?
What is the purpose of tamper-evident seals?
Which situation would increase the risk of a wet pack?
Which situation would increase the risk of a wet pack?