CHOOSE THE BEST ANSWER Great jerboas and Severtzov’s jerboas…
CHOOSE THE BEST ANSWER Great jerboas and Severtzov’s jerboas are both small rodents native to arid regions, and they look nearly identical to each other. You sequence one gene present in both species, as well as the same gene in the Four-toed jerboa and the Lesser fat-tailed jerboa. You obtain the following results: Great jerboa: GGATCCAGATCTGTCGAACTFour-toed jerboa: GGATCGAGATCTGTGCAACTLesser fat-tailed jerboa: GGATCCAGATCGTTGGAAGTSevertzov’s jerboa: GGATCCAGATCTGTCGAGCT Based on the data, which species is most closely related to the Great jerboa?