In the cDNA synthesis process, after degrading the mRNA stra…
In the cDNA synthesis process, after degrading the mRNA strands that are base paired with the first strands of DNA, you synthesize the second strand of DNA (to make double stranded DNA). Using the resulting complex pool of double stranded DNA (that you’ve made) as template you carry out PCR with primers shown below with the goal of amplifying just one specific part of the human oxytocin/neurophysin gene, also shown below. >Human Oxytocin/Neurophysin cDNA (5’UTR: 36nt; CDS: 378nt; 3’UTR: 94nt) ACCAGTCACGGACCCTGGACCCAGCGCACCCGCACCATGGCCGGCCCCAGCCTCGCTTGCTGTCTGCTCGGCCTCCTGGCGCTGACCTC CGCCTGCTACATCCAGAACTGCCCCCTGGGAGGCAAGAGGGCCGCGCCGGACCTCGACGTGCGCAAGTGCCTCCCCTGCGGCCCCGGGG GCAAAGGCCGCTGCTTCGGGCCCAATATCTGCTGCGCGGAAGAGCTGGGCTGCTTCGTGGGCACCGCCGAAGCGCTGCGCTGCCAGGAG GAGAACTACCTGCCGTCGCCCTGCCAGTCCGGCCAGAAGGCGTGCGGGAGCGGGGGCCGCTGCGCGGTCTTGGGCCTCTGCTGCAGCCC GGACGGCTGCCACGCCGACCCTGCCTGCGACGCGGAAGCCACCTTCTCCCAGCGCTGAAACTTGATGGCTCCGAACACCCTCGAAGCGC GCCACTCGCTTCCCCCATAGCCACCCCAGAAATGGTGAAAATAAAATAAAGCAGGTTTTTCTCCTCTAAAAAAAAAAAAAAAAAAAAAA Figure 1. The human oxytocin-neurophysin mRNA (cDNA) sequence. Start codon is bolded. Stop codon is bolded. Forward primer 5’ AAGCTTATGGCCGGCCCCAGCCTCGC (with added HindIII linker) Reverse primer 5’ GAATTCTCAGCGCTGGGAGAAGGTGG (with added EcoRI linker) Figure 2. The primers used in the polymerase chain reaction. Target-matching section of the primer is underlined. The added recognition sequence and and cut site for one of two restriction enzymes is shown in italics. What human genetic information would this polymerase chain reaction amplify?