Kangaroo rats (actually mice) from the deserts of the southw…
Kangaroo rats (actually mice) from the deserts of the southwestern United States look nearly identical to jerboas (also mice) from the deserts of Africa. You sequence one gene present in both species, as well as the same gene in the U.S. pocket mouse and the African jumping mouse. You obtain the following results. pocket mouse: GGACGCAGATCATTAGGACTjumping mouse: GGATCGAGATCTGTCGAACTkangaroo rat: GGACCCAGATCAGTAGGACTjerboa: GGATCCAGATCTGTCGGAGT Based on the data, which species is most closely related to the jerboa?