Use the template DNA strand below and convert the DNA sequen…
Use the template DNA strand below and convert the DNA sequence to RNA, and the RNA sequence to the amino acid sequence (10 points). 5’ ATGCCCTATCGCAATTATCGATAG 3’ 3’ TACGGGATAGCGTTAATAGCTATC 5’ The 3’ à 5’ strand is your template What is your mRNA going to look like? Write the mRNA sequence. Using the table provided, construct your protein sequence Protein sequence =