Skip to main navigationSkip to main contentSkip to footer
Wiki Cram
  • Home
  • Blog
Wiki Cram

What would happen, if anything, to the amino acid sequence i…

What would happen, if anything, to the amino acid sequence if there was an insertion of a T between nucleotides 13 and 14 in the DNA sequence? Here’s the DNA sequence again: 3’AAATTCACCTACATGGCGTTGCGCGAATGCTAGAATACCGCTCTCATTAGAAATCAAATC 5’

What would happen, if anything, to the amino acid sequence i…

Posted on: June 5, 2025 Last updated on: June 5, 2025 Written by: Anonymous Categorized in: Uncategorized
Skip back to main navigation
Powered by Studyeffect

Post navigation

Previous Post Receptors for hydrophilic signal molecules will be found whe…
Next Post How does an allosteric activator affect an enzyme?
  • Privacy Policy
  • Terms of Service
Copyright © 2025 WIKI CRAM — Powered by NanoSpace