You are studying three newly discovered butterfly species fo…
You are studying three newly discovered butterfly species found in a remote, isolated part of the Amazon. To determine how they are related to the more common butterfly species found throughout the Amazon, you collect and sequence a DNA sample from each species. Below are the results, shown as a single strand of DNA for each species. Common butterfly: GGATCCAGATCTGTCGGAGTNew species 1: GGACGCAGATCATTAGGACTNew species 2: GGATCGAGATCTGTCGAACTNew species 3: GGACCCAGATCAGTAGGACT Based on these data, what species is most closely related to the common butterfly species?